Fiveable

💻Computational Biology Unit 2 Review

QR code for Computational Biology practice questions

2.3 Data formats and parsing (FASTA, FASTQ, GenBank, PDB, etc.)

2.3 Data formats and parsing (FASTA, FASTQ, GenBank, PDB, etc.)

Written by the Fiveable Content Team • Last updated August 2024
Written by the Fiveable Content Team • Last updated August 2024
💻Computational Biology
Unit & Topic Study Guides

Biological data comes in various formats, each serving a specific purpose. FASTA, FASTQ, GenBank, and PDB are common file types used to store genetic sequences, quality scores, annotations, and protein structures. Understanding these formats is crucial for working with biological data.

Parsing these files allows researchers to extract valuable information for analysis. Python libraries like BioPython simplify this process, enabling scientists to manipulate and analyze genetic data efficiently. This knowledge is essential for computational biology and bioinformatics applications.

Biological Data File Formats

Common File Formats in Biological Databases

  • Recognize common file formats used in biological databases
    • FASTA represents nucleotide or amino acid sequences with a header line starting with ">" (DNA, RNA, protein sequences)
    • FASTQ stores biological sequences and their corresponding quality scores, commonly used for high-throughput sequencing data (Illumina, PacBio)
    • GenBank format used by the NCBI database to store annotated nucleotide sequences, including features such as genes, regulatory elements, and translations
    • PDB (Protein Data Bank) format stores 3D structural information of biological macromolecules (proteins, nucleic acids)
    • Other common formats include
      • SAM/BAM (Sequence Alignment/Map format)
      • VCF (Variant Call Format)
      • GFF (General Feature Format)

FASTA, FASTQ, GenBank, and PDB Structure

FASTA Format Structure

  • FASTA format consists of two main components
    • Header line starting with ">" followed by the sequence identifier and optional description
    • Subsequent lines containing the sequence data (nucleotides or amino acids)
  • Example FASTA record:
    </>Code
    >sequence_identifier optional description
    ATGCTAGCTACGATCGATCGATCGATCGTAGCTAGCATCG
    ATCGATCGATCGATCGATCGATCGATCGATCGATCGATCG

FASTQ Format Structure

  • FASTQ format includes four lines per record
    • Header starting with "@" containing sequence identifier and optional description
    • Sequence line containing the raw sequence data (nucleotides)
    • Separator line consisting of a "+" sign
    • Quality score line containing ASCII characters representing the quality scores for each base in the sequence
  • Example FASTQ record:
    </>Code
    @sequence_identifier optional description
    ATGCTAGCTACGATCGATCGATCGATCGTAGCTAGCATCG
    +
    !''*((((***+))%%%++)(%%%%).1***-+*''))**
Common File Formats in Biological Databases, FASTQ Sequence Quality Format

GenBank Format Structure

  • GenBank format is divided into fields, each starting with a specific keyword followed by the corresponding information
    • LOCUS field provides a brief description of the sequence, including its length, type, and accession number
    • DEFINITION field gives a concise description of the sequence
    • ACCESSION field lists the unique identifier assigned to the sequence by GenBank
    • FEATURES field contains annotations of the sequence, such as genes, coding regions, and regulatory elements
  • Example GenBank record snippet:
    </>Code
    LOCUS       SCU49845                5028 bp    DNA     linear   PLN 23-MAR-2010
    DEFINITION  Saccharomyces cerevisiae TCP1-beta gene, partial cds.
    ACCESSION   U49845
    FEATURES             Location/Qualifiers
         source          1..5028
                         /organism="Saccharomyces cerevisiae"
                         /db_xref="taxon:4932"

PDB Format Structure

  • PDB format is divided into sections with specific column-based formatting for each section
    • HEADER section contains general information about the structure, such as the experimental method and resolution
    • TITLE section provides a descriptive title for the structure
    • ATOM section contains the 3D coordinates and additional information for each atom in the structure
  • Example PDB record snippet:
    </>Code
    HEADER    TRANSFERASE                             22-NOV-91   1TRP
    TITLE     REFINEMENT OF INDOLE-3-GLYCEROPHOSPHATE SYNTHASE FROM YEAST
    ATOM      1  N   TRP A   1      17.047  14.099   3.625  1.00 13.79           N
    ATOM      2  CA  TRP A   1      16.967  12.784   4.338  1.00 10.80           C

Data Extraction from File Formats

Parsing Biological Data Files

  • Use programming languages to read and parse biological data files
    • Python, R, and Perl are commonly used for parsing biological data
    • Utilize built-in functions or libraries to handle specific file formats and simplify data extraction
      • BioPython library in Python
      • Bioconductor packages in R
  • Implement custom parsing algorithms to extract relevant information from the files
    • Sequence identifiers
    • Raw sequences (nucleotides or amino acids)
    • Quality scores (in FASTQ files)
    • Annotation details (in GenBank files)
  • Handle edge cases and potential formatting inconsistencies in the input files to ensure robust parsing
    • Missing or malformed headers
    • Inconsistent line breaks or delimiters
    • Incomplete or corrupted records
Common File Formats in Biological Databases, Hands-on: A short introduction to Galaxy / A short introduction to Galaxy / Introduction to ...

Data Conversion and Quality Control

  • Convert data between different file formats as needed for downstream analyses or compatibility with specific tools
    • Convert FASTQ to FASTA format by extracting only the sequence data
    • Convert GenBank to FASTA format by extracting the nucleotide sequences
    • Convert PDB to FASTA format by extracting the amino acid sequences
  • Perform quality control checks on the parsed data
    • Filter low-quality sequences based on quality score thresholds (FASTQ)
    • Trim adapters or contaminating sequences
    • Remove duplicate sequences
    • Validate the integrity and completeness of the parsed data

Data Manipulation and Analysis

Data Integration and Computational Tasks

  • Integrate data from multiple file formats to gain a comprehensive understanding of the biological system under study
    • Combine sequence data (FASTA) with quality scores (FASTQ) and annotations (GenBank)
    • Integrate structural information (PDB) with functional annotations (GenBank)
  • Use the extracted data for various computational tasks
    • Sequence alignment (pairwise or multiple sequence alignment)
    • Variant calling (identifying genetic variations)
    • Structure prediction (predicting protein 3D structures)
    • Data visualization (generating plots, graphs, or interactive visualizations)

Statistical Analysis and Machine Learning

  • Apply statistical methods to analyze and interpret the data obtained from the parsed files
    • Calculate sequence similarity scores or distances
    • Perform statistical tests to identify significant differences or associations
    • Conduct enrichment analyses to identify overrepresented functional categories or motifs
  • Utilize machine learning techniques to extract insights and make predictions based on the parsed data
    • Train classifiers to predict protein functions or subcellular localization
    • Develop predictive models for disease diagnosis or drug response based on genetic variations
    • Apply clustering algorithms to identify patterns or groups within the data
Pep mascot
Upgrade your Fiveable account to print any study guide

Download study guides as beautiful PDFs See example

Print or share PDFs with your students

Always prints our latest, updated content

Mark up and annotate as you study

Click below to go to billing portal → update your plan → choose Yearly → and select "Fiveable Share Plan". Only pay the difference

Plan is open to all students, teachers, parents, etc
Pep mascot
Upgrade your Fiveable account to export vocabulary

Download study guides as beautiful PDFs See example

Print or share PDFs with your students

Always prints our latest, updated content

Mark up and annotate as you study

Plan is open to all students, teachers, parents, etc
report an error
description

screenshots help us find and fix the issue faster (optional)

add screenshot

2,589 studying →